DNA sequencing gel Forward reaction DNA sequence (e value: 5e-44) GCCGTTGTTGAGTCGCAACAAAAAGCCCCCACCTTTCGGTGGGGGCTTTCCGATTCAACTGACGCTGAATCTTTTGGAGACTTCAGCCTCAGCCGATGGCG Reverse reaction DNA sequence (e value: 5e-44) GGCATCCGTGAGCCCGTCGCTGGCTCCCTGATCTACGGCAACAACATCATCTCCGGTGCTGTTGTGCCCTCCTCGAACGCCATCGGCCTTCACTTCTATCC The sequenced gene belongs to the psbA multigene family and codes for the D1 protein of photosystem II (PSII) in cyanobacteria such as Synechococcus WH7803. The D1 protein forms the core of the PSII’s reaction centre … Read More»

Using the Southern Blot Technique to Detect the Ultrabithorax gene in the Genomic DNA of the Drosophila melanogaster and the pET19 – Ubx plasmid Post Digestion by BamHI, NdeI, and BanII Restriction Enzymes Abstract: The Southern blot technique is used to detect targeted DNA sequences in DNA containing samples. In order to run the sample on an agarose gel … Read More»

The Human Spleen Description   The spleen is an organ system located in the upper far left part of the abdomen, to the left of the stomach. I chose to discuss this organ because it is often neglected as essential and I wanted to know how it impacts one’s health. This organ fluctuates in size … Read More»

Research Article   The Difference of the Polymorphism of RS4360791 Loci of ALOX5AP Gene between Cerebral Infarction of the Uygur andHan Ethnic Groups InXinjiang 1.       Abstract Objective：To explore the difference of the polymorphism of RS4360791 loci of ALOX5AP gene between cerebral infarction of the Uygur and Han ethnic groups in Xinjiang Province, China. Methods：This is … Read More»

Handroanthusimpetiginosus (Mart. ex DC.) Mattos “Ipê roxo”, “ipê rosa” or “pink lapacho” “Ipê roxo is a common name for Handroanthusimpeginosus. “Ipê” is a tupi[1] word that main “thick bark tree” and “roxo” is a Brazilian word for purple. Even the flowers being pink the most common name for the tree is purple ipê. The group of Ipês are broadly used in … Read More»

The Effect of Exposure to Synthetic Estrogen on Fish Populations In a world full of pharmaceutical drugs and hormone replacement, pharmacists and toxicologists alike squabble with the implications of improper chemical disposal. Fewer professionals fully analyze how these chemicals are making it into the aquatic environment in ways other than improper disposal and to the … Read More»

Compare and contrast sexual and asexual reproduction in plants and give medicinal plant examples. Introduction Plants are eukaryotic organisms that evolved over billions of years. There is enormous diversity in reproductive strategy in plants. Eukaryotes have nuclei in each cell that contain DNA coiled into chromosomes. Chromosomes are the organism’s reproductive functional unit and occur in single … Read More»

How did moggy become so tame? History In Cyprus 9.5 kya, and later Asia, as humans shifted towards more agricultural lifestyles, we see the first evidence of the domestic cat (Felis silvestirs catus) 1, 2. This may have been a result of the benefit cats provide farmers through vermin control. Today, the domestic cat is one of … Read More»

Master’s degree proposal Introduction Aedes aegypti As a well-known vector of diseases such as Yellow Fever, Dengue, Chikungunya, and Zika virus the Aedes aegypti have remained a global health issue. The ancestral roots of this species are suspected to have begun in the sub-Saharan region on the continent of Africa as a tree-hole laying mosquito that feeds … Read More»

CGRP Receptor activation Proposal Summary The calcitonin gene-related peptide (CGRP) receptor is a complex of calcitonin receptor-like receptor (CLR) and receptor activity-modifying protein 1 (RAMP1). This receptor plays an important role in vasodilation, neurogenic inflammation and is involved in the pathology of migraine. Though mechanisms have been proposed, it is largely unknown how exactly the … Read More»